acss2

Ensembl ID:
ENSDARG00000037781
ZFIN ID:
ZDB-GENE-040718-388
Description:
acetyl-coenzyme A synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001002641]
Human Orthologue:
ACSS2
Human Description:
acyl-CoA synthetase short-chain family member 2 [Source:HGNC Symbol;Acc:15814]
Mouse Orthologue:
Acss2
Mouse Description:
acyl-CoA synthetase short-chain family member 2 Gene [Source:MGI Symbol;Acc:MGI:1890410]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37622 Nonsense Mutation detected in F1 DNA During 2016
sa24258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054   None 415 None 11
ENSDART00000125122 Nonsense 263 698 8 19
ENSDART00000138745   None 269 None 9
ENSDART00000141235 Nonsense 263 422 8 11
Genomic Location (Zv9):
Chromosome 23 (position 9367175)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9325316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTTCAGTGTGAGTAACCTCTCCATTAACCCCCTTTAGCAGGAGAAA[C/T]AGAAAGAAAGAGTAAGGAAGGTCCGTCCCCCTCCACAGGTATTTCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Essential Splice Site 95 415 2 11
ENSDART00000125122 Essential Splice Site 378 698 10 19
ENSDART00000138745   None 269 None 9
ENSDART00000141235 Essential Splice Site 378 422 10 11
Genomic Location (Zv9):
Chromosome 23 (position 9379658)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9337799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATACATCACGTATGGGCCCTTGGCCAATGGGGCGACCAGTGTGTTGG[T/C]AAGGGGAACACCCTGATAAGCATTATTTGTGTCAGATTTTTGCATAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link