acss2

Ensembl ID:
ENSDARG00000037781
ZFIN ID:
ZDB-GENE-040718-388
Description:
acetyl-coenzyme A synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001002641]
Human Orthologue:
ACSS2
Human Description:
acyl-CoA synthetase short-chain family member 2 [Source:HGNC Symbol;Acc:15814]
Mouse Orthologue:
Acss2
Mouse Description:
acyl-CoA synthetase short-chain family member 2 Gene [Source:MGI Symbol;Acc:MGI:1890410]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3251 Nonsense Mutation detected in F1 DNA During 2014
sa24258 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Nonsense 84 415 2 11
ENSDART00000125122 Nonsense 367 698 10 19
ENSDART00000138745 None None 269 None 9
ENSDART00000141235 Nonsense 367 422 10 11
Genomic Location:
Chromosome 23 (position 9379623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGCACCGCTGACATCGGCTGGATCACCGGCCACTCATACATCACGTA[T/A]GGGCCCTTGGCCAATGGGGCGACMAGTGTGTTGGTAAGGGGAACACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Essential Splice Site 95 415 2 11
ENSDART00000125122 Essential Splice Site 378 698 10 19
ENSDART00000138745 None None 269 None 9
ENSDART00000141235 Essential Splice Site 378 422 10 11
Genomic Location:
Chromosome 23 (position 9379658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATACATCACGTATGGGCCCTTGGCCAATGGGGCGACCAGTGTGTTGG[T/C]AAGGGGAACACCCTGATAAGCATTATTTGTGTCAGATTTTTGCATAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ydbawyq