acss2

Ensembl ID:
ENSDARG00000037781
ZFIN ID:
ZDB-GENE-040718-388
Description:
acetyl-coenzyme A synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001002641]
Human Orthologue:
ACSS2
Human Description:
acyl-CoA synthetase short-chain family member 2 [Source:HGNC Symbol;Acc:15814]
Mouse Orthologue:
Acss2
Mouse Description:
acyl-CoA synthetase short-chain family member 2 Gene [Source:MGI Symbol;Acc:MGI:1890410]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37622 Nonsense Mutation detected in F1 DNA During 2016
sa3251 Nonsense Mutation detected in F1 DNA During 2016
sa24258 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054   None 415 None 11
ENSDART00000125122 Nonsense 263 698 8 19
ENSDART00000138745   None 269 None 9
ENSDART00000141235 Nonsense 263 422 8 11
Genomic Location:
Chromosome 23 (position 9367175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTTCAGTGTGAGTAACCTCTCCATTAACCCCCTTTAGCAGGAGAAA[C/T]AGAAAGAAAGAGTAAGGAAGGTCCGTCCCCCTCCACAGGTATTTCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Nonsense 84 415 2 11
ENSDART00000125122 Nonsense 367 698 10 19
ENSDART00000138745   None 269 None 9
ENSDART00000141235 Nonsense 367 422 10 11
Genomic Location:
Chromosome 23 (position 9379623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGCACCGCTGACATCGGCTGGATCACCGGCCACTCATACATCACGTA[T/A]GGGCCCTTGGCCAATGGGGCGACMAGTGTGTTGGTAAGGGGAACACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Essential Splice Site 95 415 2 11
ENSDART00000125122 Essential Splice Site 378 698 10 19
ENSDART00000138745   None 269 None 9
ENSDART00000141235 Essential Splice Site 378 422 10 11
Genomic Location:
Chromosome 23 (position 9379658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATACATCACGTATGGGCCCTTGGCCAATGGGGCGACCAGTGTGTTGG[T/C]AAGGGGAACACCCTGATAAGCATTATTTGTGTCAGATTTTTGCATAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link