rybpa

Ensembl ID:
ENSDARG00000037773
ZFIN ID:
ZDB-GENE-030424-3
Description:
RING1 and YY1-binding protein A [Source:UniProtKB/Swiss-Prot;Acc:Q7SYB3]
Human Orthologue:
RYBP
Human Description:
RING1 and YY1 binding protein [Source:HGNC Symbol;Acc:10480]
Mouse Orthologue:
Rybp
Mouse Description:
RING1 and YY1 binding protein Gene [Source:MGI Symbol;Acc:MGI:1929059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32426 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055038 Nonsense 185 384 3 5
Genomic Location (Zv9):
Chromosome 23 (position 10878086)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10836888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACAGCAGCCGCAGCAGCCACAGCAGCATTCGCAGCAACAGCCACAG[C/T]AGCATCCGCCGCAGCAACACAACAGAATAGACAGAGAGCACACAGACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link