tlr2

Ensembl ID:
ENSDARG00000037758
ZFIN ID:
ZDB-GENE-040219-6
Description:
toll-like receptor 2 [Source:RefSeq peptide;Acc:NP_997977]
Human Orthologue:
TLR2
Human Description:
toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
Mouse Orthologue:
Tlr2
Mouse Description:
toll-like receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1346060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19423 Nonsense Available for shipment Available now
sa6574 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 519 788 1 1
ENSDART00000122568 Nonsense 549 818 2 2
Genomic Location:
Chromosome 1 (position 8063777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTGCTGATACAAAGGAACGCCTTACGGATGTTCAACCAAAGCTCTT[T/A]GAGGAGTTTTAAAACTCTGCTTTACTTGGAGGCAGGTGCCAACAATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 695 788 1 1
ENSDART00000122568 Nonsense 725 818 2 2
Genomic Location:
Chromosome 1 (position 8064304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACTTCAGRCCGGGCCGCTGGATCGTGGACAAYATCATTGACTCAATT[G/T]AAAAGAGCTATCGAACTCTKTTTGTTCTGTCGGAGCACTTTGTGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3mdhzadn