tlr2

Ensembl ID:
ENSDARG00000037758
ZFIN ID:
ZDB-GENE-040219-6
Description:
toll-like receptor 2 [Source:RefSeq peptide;Acc:NP_997977]
Human Orthologue:
TLR2
Human Description:
toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
Mouse Orthologue:
Tlr2
Mouse Description:
toll-like receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1346060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39548 Nonsense Mutation detected in F1 DNA During 2016
sa19423 Nonsense Available for shipment Available now
sa6574 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 121 788 1 1
ENSDART00000122568 Nonsense 151 818 2 2
Genomic Location:
Chromosome 1 (position 8062583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCTTAAACAACCTGAACAATCTCTCTCCGTCTTGGTTTCACAAGT[T/A]AAAATCTCTCCAGCAACTTAACCTTGTAGGAAACCCATACTCAACTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 519 788 1 1
ENSDART00000122568 Nonsense 549 818 2 2
Genomic Location:
Chromosome 1 (position 8063777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTGCTGATACAAAGGAACGCCTTACGGATGTTCAACCAAAGCTCTT[T/A]GAGGAGTTTTAAAACTCTGCTTTACTTGGAGGCAGGTGCCAACAATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 695 788 1 1
ENSDART00000122568 Nonsense 725 818 2 2
Genomic Location:
Chromosome 1 (position 8064304)
KASP Assay ID:
554-5103.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACTTCAGRCCGGGCCGCTGGATCGTGGACAAYATCATTGACTCAATT[G/T]AAAAGAGCTATCGAACTCTKTTTGTTCTGTCGGAGCACTTTGTGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link