NP_001076338.1

Ensembl ID:
ENSDARG00000037747
Description:
hypothetical protein LOC570314 [Source:RefSeq peptide;Acc:NP_001076338]
Human Orthologue:
FSCN1
Human Description:
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) [Source:HGNC Symbol;Acc:111
Mouse Orthologue:
Fscn1
Mouse Description:
fascin homolog 1, actin bundling protein (Strongylocentrotus purpuratus) Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9138 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39546 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054989 Essential Splice Site 283 501 1 5
Genomic Location (Zv9):
Chromosome 1 (position 7739455)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7979260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGTGGTGCTCACCGCCAGCAATGACAGAAACATCTCCATGCGCCAGG[G/A]TGAGATGCCAATGCAGCATGCTCACTCATTAATATTAATAATGCTTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054989 Essential Splice Site 377 501 4 5
Genomic Location (Zv9):
Chromosome 1 (position 7743634)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7983439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCATAGGTAACGATGTACTGTGTGTAGAGTAGCTGATGTTGTTTTACA[G/T]GCGAGCAGGAGGAGTTTGTGTTGAAGCTCATCAACAGGCCGCTGATTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link