fbxl3

Ensembl ID:
ENSDARG00000037738
Mouse Orthologue:
Fbxl21
Mouse Description:
F-box and leucine-rich repeat protein 21 Gene [Source:MGI Symbol;Acc:MGI:2442921]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16178 Nonsense Available for shipment Available now
sa16295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054396 Nonsense 28 436 1 4
Genomic Location:
Chromosome 14 (position 23388661)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCATCAGAGGGCAGAAACAAGAGACACAGAAGCACCACACCAGTGTA[T/A]GTCCAGACAGGCTCMACCAATTTTCASAACRCCACAGAGGAGACATGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054396 Nonsense 170 436 3 4
Genomic Location:
Chromosome 14 (position 23379335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGACTTTGCCTGTCTTGTCTGGTCTGTTCTCAGTCACACTTTGTCT[C/A]GGCCCTGACGGTGGTGTTTGTGAATTCSAAGTCTCTTTMCTCTATAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5qb49ubz