usp34

Ensembl ID:
ENSDARG00000037734
ZFIN IDs:
ZDB-GENE-100210-6, ZDB-GENE-100210-6
Description:
LOC562779 protein [Source:UniProtKB/TrEMBL;Acc:A8WFZ5]
Human Orthologue:
USP34
Human Description:
ubiquitin specific peptidase 34 [Source:HGNC Symbol;Acc:20066]
Mouse Orthologue:
Usp34
Mouse Description:
ubiquitin specific peptidase 34 Gene [Source:MGI Symbol;Acc:MGI:109473]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24858 Nonsense Mutation detected in F1 DNA During 2014
sa19608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054959 Nonsense 97 582 3 14
ENSDART00000129883 Nonsense 97 582 3 14
Genomic Location:
Chromosome 1 (position 54205278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACGCTGTGGCGATGGCAACAGTAGGACTGAAGGGGCGGAGTCTGACT[G/A]GGGCTCCGCCCAACCACAGCCTTCACCCAATGAGGACGAGCCTCTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054959 Nonsense 292 582 7 14
ENSDART00000129883 Nonsense 292 582 7 14
Genomic Location:
Chromosome 1 (position 54190856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTTTTACTCTTTGTTTTTGTGTGCGTGTGTGTGTGTGTGTGCAGGTA[T/G]CTGTGTAAGCTGTCAGATCAGGAGCTGCGTCAGAGTGCTGCACGTAACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gr2jes6b