gss

Ensembl ID:
ENSDARG00000037706
ZFIN ID:
ZDB-GENE-041010-208
Description:
glutathione synthetase [Source:RefSeq peptide;Acc:NP_001006104]
Human Orthologue:
GSS
Human Description:
glutathione synthetase [Source:HGNC Symbol;Acc:4624]
Mouse Orthologue:
Gss
Mouse Description:
glutathione synthetase Gene [Source:MGI Symbol;Acc:MGI:95852]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43926 Nonsense Mutation detected in F1 DNA During 2016
sa12621 Essential Splice Site Available for shipment Available now
sa12631 Essential Splice Site Available for shipment Available now
sa29894 Essential Splice Site Mutation detected in F1 DNA During 2016
sa688 Nonsense Available for shipment Available now
sa37644 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Nonsense 12 475 2 13
Genomic Location (Zv9):
Chromosome 23 (position 14878844)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15010777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGATTTAGTACTATGTCTGTCAAACTGGAGGACACCCTGAAAGAT[G/T]AAAACCTGATCAAACGTTTAGAGGAGATAGCAAAAGACACGGCGCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 43 475 2 13
ENSDART00000054909 Essential Splice Site 43 475 2 13
Genomic Location (Zv9):
Chromosome 23 (position 14878748)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15010681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 43 475 2 13
ENSDART00000054909 Essential Splice Site 43 475 2 13
Genomic Location (Zv9):
Chromosome 23 (position 14878748)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15010681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 118 475 5 13
Genomic Location (Zv9):
Chromosome 23 (position 14875375)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15007308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTATATAGATGTAAATCTTAATTTATTTAACTCCTCTTTCATTCAA[G/A]AAAATAGTAGTGGGTCTGAATCGCTCAGACTACATGTTAGACCACAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Nonsense 158 475 5 13
Genomic Location (Zv9):
Chromosome 23 (position 14875254)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15007187
KASP Assay ID:
554-0596.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGATTGAAATCAACACTATTGCTGCGAGTTTTGGTGGTCTTGCTTCA[C/T]GAACACCAGATGTCCATCGGTAAGTCTGACCATACATTTTAAGTGGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 164 475 5 13
Genomic Location (Zv9):
Chromosome 23 (position 14875233)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15007166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGCGAGTTTTGGTGGTCTTGCTTCACGAACACCAGATGTCCATCGG[T/G]AAGTCTGACCATACATTTTAAGTGGACCTATTATGCAAAAAAAAAATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link