gss

Ensembl ID:
ENSDARG00000037706
ZFIN ID:
ZDB-GENE-041010-208
Description:
glutathione synthetase [Source:RefSeq peptide;Acc:NP_001006104]
Human Orthologue:
GSS
Human Description:
glutathione synthetase [Source:HGNC Symbol;Acc:4624]
Mouse Orthologue:
Gss
Mouse Description:
glutathione synthetase Gene [Source:MGI Symbol;Acc:MGI:95852]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12621 Essential Splice Site Available for shipment Available now
sa12631 Essential Splice Site Available for shipment Available now
sa688 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 43 475 2 13
ENSDART00000054909 Essential Splice Site 43 475 2 13
Genomic Location:
Chromosome 23 (position 14878748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Essential Splice Site 43 475 2 13
ENSDART00000054909 Essential Splice Site 43 475 2 13
Genomic Location:
Chromosome 23 (position 14878748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054909 Nonsense 158 475 5 13
Genomic Location:
Chromosome 23 (position 14875254)
KASP Assay ID:
554-0596.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGATTGAAATCAACACTATTGCTGCGAGTTTTGGTGGTCTTGCTTCA[C/T]GAACACCAGATGTCCATCGGTAAGTCTGACCATACATTTTAAGTGGACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yvyurhis