npm4

Ensembl ID:
ENSDARG00000037675
ZFIN ID:
ZDB-GENE-080723-7
Description:
nucleophosmin [Source:RefSeq peptide;Acc:NP_001159627]
Human Orthologue:
NPM1
Human Description:
nucleophosmin (nucleolar phosphoprotein B23, numatrin) [Source:HGNC Symbol;Acc:7910]
Mouse Orthologues:
AC154357.1, Npm1
Mouse Description:
nucleophosmin 1 Gene [Source:MGI Symbol;Acc:MGI:106184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22416 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054876 Essential Splice Site 33 316 1 12
Genomic Location (Zv9):
Chromosome 14 (position 5648491)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 5335488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGAGGATAACATTAAAGACCTCAGCCGACCCCAGATGTATTTGTTTG[G/A]TGAGCTGAATTAAAATCACACGTTGCATAACCATATATATGCGACAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link