fnta

Ensembl ID:
ENSDARG00000037665
ZFIN ID:
ZDB-GENE-030131-866
Description:
farnesyltransferase, CAAX box, alpha [Source:RefSeq peptide;Acc:NP_001074029]
Human Orthologues:
FNTA, RP11-598P20.5
Human Description:
farnesyltransferase, CAAX box, alpha [Source:HGNC Symbol;Acc:3782]
Mouse Orthologue:
Fnta
Mouse Description:
farnesyltransferase, CAAX box, alpha Gene [Source:MGI Symbol;Acc:MGI:104683]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33494 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054861 Essential Splice Site 260 374 7 9
Genomic Location (Zv9):
Chromosome 4 (position 29649102)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3417110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAAAGAAAGCTCCTCACAATGAGAGCGCTTGGAACTATTTAAAAGCG[T/C]GAGTGTTGAAAACAAATATAAGCAGCATATGAGGATTTTCTTTTCAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link