pmm2

Ensembl ID:
ENSDARG00000037654
ZFIN ID:
ZDB-GENE-030722-6
Description:
phosphomannomutase 2 [Source:RefSeq peptide;Acc:NP_956378]
Human Orthologue:
PMM2
Human Description:
phosphomannomutase 2 [Source:HGNC Symbol;Acc:9115]
Mouse Orthologue:
Pmm2
Mouse Description:
phosphomannomutase 2 Gene [Source:MGI Symbol;Acc:MGI:1859214]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18686 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10150 Essential Splice Site Available for shipment Available now
sa19432 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 152 250 5 8
ENSDART00000054848 Essential Splice Site 152 250 5 8
Genomic Location (Zv9):
Chromosome 1 (position 8941527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181332
KASP Assay ID:
2259-0209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 152 250 5 8
ENSDART00000054848 Essential Splice Site 152 250 5 8
Genomic Location (Zv9):
Chromosome 1 (position 8941527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181332
KASP Assay ID:
2259-0209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCMTWATCTTCTYAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 178 250 7 8
Genomic Location (Zv9):
Chromosome 1 (position 8941954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTTGAAATGATGCTTGTCTTTGACTCATGTATGTATTTTTCCCTGC[A/T]GGTGGACAGATCAGTTTTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link