rgs11

Ensembl ID:
ENSDARG00000037646
ZFIN ID:
ZDB-GENE-080220-46
Description:
regulator of G-protein signaling 11 [Source:RefSeq peptide;Acc:NP_001104631]
Human Orthologue:
RGS11
Human Description:
regulator of G-protein signaling 11 [Source:HGNC Symbol;Acc:9993]
Mouse Orthologue:
Rgs11
Mouse Description:
regulator of G-protein signaling 11 Gene [Source:MGI Symbol;Acc:MGI:1354739]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25529 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32597 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054829 Essential Splice Site 21 477 1 18
ENSDART00000054833 Essential Splice Site 21 359 1 16
ENSDART00000135702 Essential Splice Site 21 471 1 17
Genomic Location (Zv9):
Chromosome 1 (position 8963174)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9202979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCAGCCAGGATGGCGTGCAGAGACAGCAAATGCCCTGTTTGACCAAG[G/A]TAAACCCCACAAAATATGATTTATTTAACCATTCCATATCAAATGTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054829 Essential Splice Site 128 477 5 18
ENSDART00000054833 Essential Splice Site 123 359 5 16
ENSDART00000135702 Essential Splice Site 123 471 5 17
Genomic Location (Zv9):
Chromosome 1 (position 8969878)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9209683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTATTACTGGATGTCTACACGCTGGCCTGCTTCAGAACTAGACTATG[G/A]TAAGTGAAATTCTCACTTATTAACTCTTATGTTATTCCAAAAAGCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054829 Nonsense 172 477 7 18
ENSDART00000054833 Nonsense 167 359 7 16
ENSDART00000135702 Nonsense 167 471 7 17
Genomic Location (Zv9):
Chromosome 1 (position 8972253)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9212058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACGTATCAACCACACCTGGGACTTTGTTGTGATGCAGGCAAGAGAG[C/T]AGCTCAGGTAACTCTACGTTTCCATCACACACACGCGCACACACACACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link