gne

Ensembl ID:
ENSDARG00000037634
ZFIN ID:
ZDB-GENE-040426-1848
Description:
bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase [Source:RefSeq peptide;
Human Orthologue:
GNE
Human Description:
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase [Source:HGNC Symbol;Acc:23657]
Mouse Orthologue:
Gne
Mouse Description:
glucosamine Gene [Source:MGI Symbol;Acc:MGI:1354951]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4834 Nonsense F2 line generated During 2017
sa31197 Nonsense Available for shipment Available now
sa19447 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4834
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054814 Nonsense 347 725 6 12
ENSDART00000146549   None 214 None 4
Genomic Location (Zv9):
Chromosome 1 (position 11619391)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11636312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGAAAATGTTCTACATGTGCGAGACGCAGACACTCATAATAAAATCTA[T/A]CATGCCCTCGAGCTGCAGTTTGGAAAACGCTACCCCTGGTAATGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054814 Nonsense 439 725 8 12
ENSDART00000146549   None 214 None 4
Genomic Location (Zv9):
Chromosome 1 (position 11622106)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11639057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACGATGTGCTTTTGTGTTTCAGGGTAAAGTGGTCAAGAAGTACGTA[C/T]AGTTAAATCCCAAGACGTTTGAGGAGAGGATAGAGCTGATTCTGACCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054814 Splice Site, Nonsense 609 725 10 12
ENSDART00000146549   None 214 None 4
Genomic Location (Zv9):
Chromosome 1 (position 11625894)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11642865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATTCATCAGGTCTCGCTCTGCAGAGAGAAGCCAAGAGACTCCATGAC[G/T]GTAAGAAAACGAACAAAGAGAAAAAAAAACACAAAGCCGAATGACTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link