leng1

Ensembl ID:
ENSDARG00000037633
ZFIN ID:
ZDB-GENE-040912-159
Description:
leukocyte receptor cluster (LRC) member 1 [Source:RefSeq peptide;Acc:NP_001004591]
Human Orthologue:
LENG1
Human Description:
leukocyte receptor cluster (LRC) member 1 [Source:HGNC Symbol;Acc:15502]
Mouse Orthologue:
Leng1
Mouse Description:
leukocyte receptor cluster (LRC) member 1 Gene [Source:MGI Symbol;Acc:MGI:1917007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25021 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039109 Nonsense 273 276 4 4
Genomic Location:
Chromosome 16 (position 34372185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTCCTGAATTGGCAAGGAAAAGGCAAAGGAGAGACAGAGATCAGTA[T/A]GGCTTTTATTAGCTTACAACACTAATGATTCACTAAGTCTAGAATTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/khaz9q30