ENSDARG00000037621

Ensembl ID:
ENSDARG00000037621
Human Orthologue:
QRFPR
Human Description:
pyroglutamylated RFamide peptide receptor [Source:HGNC Symbol;Acc:15565]
Mouse Orthologues:
C130060K24Rik, Qrfpr
Mouse Descriptions:
pyroglutamylated RFamide peptide receptor Gene [Source:MGI Symbol;Acc:MGI:2677633]
RIKEN cDNA C130060K24 gene Gene [Source:MGI Symbol;Acc:MGI:2441881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19445 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054790 Nonsense 84 439 1 1
Genomic Location:
Chromosome 1 (position 10958171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGTGGGTTTCTTCGGAAATGTCATGTCCCTCAAAGTCTTACTGGGC[C/T]AGCATGGAAGTGTACGTCTGTCGGGGGTGAGCGCCACCCGCTGTCTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xno54oi0