ENSDARG00000037613

Ensembl ID:
ENSDARG00000037613
Human Orthologues:
LGALS12, LGALS8
Human Descriptions:
lectin, galactoside-binding, soluble, 12 [Source:HGNC Symbol;Acc:15788]
lectin, galactoside-binding, soluble, 8 [Source:HGNC Symbol;Acc:6569]
Mouse Orthologues:
Lgals12, Lgals8
Mouse Descriptions:
lectin, galactose binding, soluble 12 Gene [Source:MGI Symbol;Acc:MGI:1929094]
lectin, galactose binding, soluble 8 Gene [Source:MGI Symbol;Acc:MGI:1928481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054781 Nonsense 67 358 3 10
Genomic Location:
Chromosome 17 (position 49067374)
KASP Assay ID:
554-2716.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTGCAGKACAAAGCCACGGGCGGATGTGGCATTTCACTTTAATCCA[C/T]GATTCAGCAGTTCTCCACGTATCGTGTGYAACTTCTTGCATCATGAAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rjh1u2x9