LOC558290

Ensembl ID:
ENSDARG00000037587
Human Orthologues:
SYP, SYPL1, SYPL2
Human Descriptions:
synaptophysin [Source:HGNC Symbol;Acc:11506]
synaptophysin-like 1 [Source:HGNC Symbol;Acc:11507]
synaptophysin-like 2 [Source:HGNC Symbol;Acc:27638]
Mouse Orthologues:
Syp, Sypl, Sypl2
Mouse Descriptions:
synaptophysin Gene [Source:MGI Symbol;Acc:MGI:98467]
synaptophysin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1328311]
synaptophysin-like protein Gene [Source:MGI Symbol;Acc:MGI:108081]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30657 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054735 Essential Splice Site 28 288 2 6
Genomic Location (Zv9):
Chromosome 11 (position 20114357)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19531671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAAGTGCTTAAATTACCTTTGGGATTTATTCGTCTTCTGGAATGGG[T/G]AAGTGTGCTTAAAGCACGCGGTTTTTCCTCTCACCTTTTCTGTAACTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link