rps6kal

Ensembl ID:
ENSDARG00000037574
ZFIN ID:
ZDB-GENE-030131-9616
Description:
Ribosomal protein S6 kinase alpha-6 [Source:UniProtKB/Swiss-Prot;Acc:Q6PFQ0]
Human Orthologue:
RPS6KA6
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
Mouse Orthologue:
Rps6ka6
Mouse Description:
ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22425 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42349 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18445 Nonsense Available for shipment Available now
sa38980 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047993 Essential Splice Site 108 740 None 22
ENSDART00000047993 Essential Splice Site 108 740 None 22

The following transcripts of ENSDARG00000037574 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 9051426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGCCAGCTTTATGCAATGAAGGTGCTCAAAAAGGCATCTTTAAAAGG[T/C]CAGCGAGTGTCTTCATCAGTGTGAGTAGTTAGTCAGCACATTTCCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047993 Essential Splice Site 108 740 None 22
ENSDART00000047993 Essential Splice Site 108 740 None 22

The following transcripts of ENSDARG00000037574 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 9051426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGCCAGCTTTATGCAATGAAGGTGCTCAAAAAGGCATCTTTAAAAGG[T/C]CAGCGAGTGTCTTCATCAGTGTGAGTAGTTAGTCAGCACATTTCCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047993 Nonsense 335 740 13 22

The following transcripts of ENSDARG00000037574 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 9071616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTTTWTTGGAGTATCATGTGTTTATTGTGTCTGTGTAGAARTTGTA[C/A]CGAAGAGAACTTCAGCCTCCATTCAAACCTGCTTCAGGGAAACCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047993 Essential Splice Site 408 740 14 22

The following transcripts of ENSDARG00000037574 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 9071956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAAAGTAAAAGTGCGCCACTAGTCAACATTCTCCCCATAGTGCAGG[T/A]AAATCTCTCTCTTTTACTATGCATATGTGTGAATTATACATGTTTGGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link