LOC100329711

Ensembl ID:
ENSDARG00000037566
Human Orthologue:
FIG4
Human Description:
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) [Source:HGNC Symbol;Acc:16873
Mouse Orthologue:
Fig4
Mouse Description:
FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30397 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054706 Nonsense 23 291 2 7
Genomic Location (Zv9):
Chromosome Zv9_NA132 (position 30521)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149749.1 30521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATACTTGATAACTTTTGTCTGTGTTTGTTTGTTTGTTTGTCAGCGGTA[T/A]TTCCTGGTGGGCAGCAATAATGCTCAAACCAAACACCGTGTGCTGAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link