uba1

Ensembl ID:
ENSDARG00000037559
ZFIN ID:
ZDB-GENE-040426-2009
Description:
ubiquitin-like modifier-activating enzyme 1 [Source:RefSeq peptide;Acc:NP_998227]
Human Orthologue:
UBA1
Human Description:
ubiquitin-like modifier activating enzyme 1 [Source:HGNC Symbol;Acc:12469]
Mouse Orthologues:
AC007585.1, Uba1, Ube1y1
Mouse Descriptions:
ubiquitin-activating enzyme E1, Chr Y 1 Gene [Source:MGI Symbol;Acc:MGI:98891]
ubiquitin-like modifier activating enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:98890]
Ubiquitin-like modifier-activating enzyme 1 Y [Source:UniProtKB/Swiss-Prot;Acc:P31254]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37679 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15137 Nonsense Available for shipment Available now
sa37680 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054691 Essential Splice Site 304 1058 10 26
ENSDART00000133131   None 196 None 6
ENSDART00000147382   None 93 None 4

The following transcripts of ENSDARG00000037559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20941458)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20726565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATAAATTAAATCCCCTGCTGGATTTTAAACGCACTTCTTTCTTCACC[A/T]GAAATCCCTGTCCTCCTCCATGGCCGAACCAGAGTTCTTGCTGACTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054691 Nonsense 374 1058 11 26
ENSDART00000133131   None 196 None 6
ENSDART00000147382   None 93 None 4

The following transcripts of ENSDARG00000037559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20942471)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20727578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTATGACTCTGGCTGAAGAGGTGAATGCTGCACAGACAGGATCTGCC[A/T]AGCAAGAGGAGCTGGACCAGGCAGTCATAAAAAAGCTGGCCTGCGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054691 Essential Splice Site 882 1058 22 26
ENSDART00000133131   None 196 None 6
ENSDART00000147382   None 93 None 4

The following transcripts of ENSDARG00000037559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20949033)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20734140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATCTGAGAGCAGAGAACTATGACATTCCTCCTGCAGACAGACACAAG[G/A]TTAGCAGGCCAGCGATTTCAAAGCTGTCCTGTGAGCTACGTATCATCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link