uba1

Ensembl ID:
ENSDARG00000037559
ZFIN ID:
ZDB-GENE-040426-2009
Description:
ubiquitin-like modifier-activating enzyme 1 [Source:RefSeq peptide;Acc:NP_998227]
Human Orthologue:
UBA1
Human Description:
ubiquitin-like modifier activating enzyme 1 [Source:HGNC Symbol;Acc:12469]
Mouse Orthologues:
AC007585.1, Uba1, Ube1y1
Mouse Descriptions:
ubiquitin-activating enzyme E1, Chr Y 1 Gene [Source:MGI Symbol;Acc:MGI:98891]
ubiquitin-like modifier activating enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:98890]
Ubiquitin-like modifier-activating enzyme 1 Y [Source:UniProtKB/Swiss-Prot;Acc:P31254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15137 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054691 Nonsense 374 1058 11 26
ENSDART00000133131 None None 196 None 6
ENSDART00000147382 None None 93 None 4

The following transcripts of ENSDARG00000037559 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20942471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTATGACTCTGGCTGAAGAGGTGAATGCTGCACAGACAGGATCTGCC[A/T]AGCAAGAGGAGCTGGACCAGGCAGTCATAAAAAAGCTGGCCTGCGTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/raboex7u