asb12b

Ensembl ID:
ENSDARG00000037558
ZFIN ID:
ZDB-GENE-040822-25
Description:
ankyrin repeat and SOCS box-containing protein 12 [Source:RefSeq peptide;Acc:NP_001004009]
Human Orthologue:
ASB12
Human Description:
ankyrin repeat and SOCS box-containing 12 [Source:HGNC Symbol;Acc:19763]
Mouse Orthologue:
Asb12
Mouse Description:
ankyrin repeat and SOCS box-containing 12 Gene [Source:MGI Symbol;Acc:MGI:1917642]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35638 Nonsense Mutation detected in F1 DNA During 2016
sa22427 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054693 Nonsense 176 308 2 3
Genomic Location:
Chromosome 14 (position 9448771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGCCAGACTGGGCCTTAAATGCCACAGCTTGCCGAGGACCACTGTA[C/A]ATTTCAGCGGTGTATGGTCATCTAGGTTGTTTCAAATTGTTGCTGCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054693 Nonsense 278 308 3 3
Genomic Location:
Chromosome 14 (position 9438597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATACGCAGTTTGTCCAAAAACACTGATGTCTCAGGTGCGACTTTCTT[T/A]ATGGAAGTTCCTTCCGGCGGAAAACAAAATGTCCTCCATAGACTGTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link