atoh8

Ensembl ID:
ENSDARG00000037555
ZFIN ID:
ZDB-GENE-061215-7
Description:
protein atonal homolog 8 [Source:RefSeq peptide;Acc:NP_001073460]
Human Orthologue:
ATOH8
Human Description:
atonal homolog 8 (Drosophila) [Source:HGNC Symbol;Acc:24126]
Mouse Orthologue:
Atoh8
Mouse Description:
atonal homolog 8 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918343]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054689 Nonsense 100 266 1 3
ENSDART00000123332 Nonsense 100 266 1 3
Genomic Location:
Chromosome 14 (position 9693948)
KASP Assay ID:
554-1390.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTAGACATGAGGATTAACACCATAACTGCAGCAGAASTACCTGACTCG[A/T]AATTAAGATCCGTCTCCGAAAAGACTGTCAACAGCAAAATAGTTCAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/533x192u