arhgef3l

Ensembl ID:
ENSDARG00000037554
ZFIN ID:
ZDB-GENE-050522-85
Description:
Rho guanine nucleotide exchange factor (GEF) 3, like [Source:RefSeq peptide;Acc:NP_001018563]
Human Orthologue:
ARHGEF3
Human Description:
Rho guanine nucleotide exchange factor (GEF) 3 [Source:HGNC Symbol;Acc:683]
Mouse Orthologue:
Arhgef3
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7504 Missense, Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054686 Missense, Splice Site 85 506 5 12
ENSDART00000127445 Missense, Splice Site 111 532 6 13
ENSDART00000138936 Missense, Splice Site 90 511 5 12
Genomic Location:
Chromosome 23 (position 20963885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGTGTTACATTTGTGTRTGTGTTTGTGCTTGGATTTTACTCCTCAG[C/T]GTTCTATCAGTTTCCGRACAGAGGCCCGGCCATTGCCTCCAATGCCAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8o80wd95