arhgef3l

Ensembl ID:
ENSDARG00000037554
ZFIN ID:
ZDB-GENE-050522-85
Description:
Rho guanine nucleotide exchange factor (GEF) 3, like [Source:RefSeq peptide;Acc:NP_001018563]
Human Orthologue:
ARHGEF3
Human Description:
Rho guanine nucleotide exchange factor (GEF) 3 [Source:HGNC Symbol;Acc:683]
Mouse Orthologue:
Arhgef3
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7504 Missense, Splice Site Mutation detected in F1 DNA During 2017
sa45000 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054686 Missense, Splice Site 85 506 5 12
ENSDART00000127445 Missense, Splice Site 111 532 6 13
ENSDART00000138936 Missense, Splice Site 90 511 5 12
Genomic Location (Zv9):
Chromosome 23 (position 20963885)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20748992
KASP Assay ID:
554-4283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGTGTTACATTTGTGTRTGTGTTTGTGCTTGGATTTTACTCCTCAG[C/T]GTTCTATCAGTTTCCGRACAGAGGCCCGGCCATTGCCTCCAATGCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054686 Essential Splice Site 159 506 6 12
ENSDART00000127445 Essential Splice Site 185 532 7 13
ENSDART00000138936 Essential Splice Site 164 511 6 12
Genomic Location (Zv9):
Chromosome 23 (position 20964559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGGGTGAGAAACAGCTCATAGAGGATCTAAGCCTCGTAAAAAAGG[T/A]TCGTCCAGGAGTTCAGCTGATTTATTTATTTCTACTGTCCTAAATGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link