il1rapl2

Ensembl ID:
ENSDARG00000037553
ZFIN ID:
ZDB-GENE-040219-5
Description:
interleukin 1 receptor accessory protein-like 2 [Source:RefSeq peptide;Acc:NP_001136056]
Human Orthologue:
IL1RAPL2
Human Description:
interleukin 1 receptor accessory protein-like 2 [Source:HGNC Symbol;Acc:5997]
Mouse Orthologue:
Il1rapl2
Mouse Description:
interleukin 1 receptor accessory protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913106]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8408 Nonsense Mutation detected in F1 DNA During 2014
sa22431 Nonsense Mutation detected in F1 DNA During 2014
sa1302 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054687 Nonsense 42 655 1 9
ENSDART00000143382 Nonsense 68 681 3 11
Genomic Location:
Chromosome 14 (position 10181091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYAAATGTGCTCTGTTCTACAGCTACATTCGCACCAACTATAGCGTGGCC[C/T]AAAATGCCAAGCTGCGGCTCATCTGGTACAGGAACAAGGGCGATTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054687 Nonsense 381 655 8 9
ENSDART00000143382 Nonsense 407 681 10 11
Genomic Location:
Chromosome 14 (position 9936371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTATCTTTTTCTTTCAGGCAACAAGGAATATGACGCCTACCTCTCTTA[T/A]ACCAAAGTGGATTTGGATTCAGTGGAGCAGGAGATGAGCGAGGAGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054687 Nonsense 481 655 9 9
ENSDART00000143382 Nonsense 507 681 11 11
Genomic Location:
Chromosome 14 (position 9916834)
KASP Assay ID:
554-1217.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGACTGCACAGCATGCTGGTGACTGGTGAAATCAAGGTGATCATGATC[G/T]AATGCCCGGACCTGCGCAGCGTTATCAACTACCAGGAGGTAGAAGACCTC
Associated Phenotype:
Data not yet available

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zk3atvn2