pm20d1.1

Ensembl ID:
ENSDARG00000037551
ZFIN ID:
ZDB-GENE-051120-102
Description:
Probable carboxypeptidase PM20D1.1 [Source:UniProtKB/Swiss-Prot;Acc:Q32LT9]
Human Orthologue:
PM20D1
Human Description:
peptidase M20 domain containing 1 [Source:HGNC Symbol;Acc:26518]
Mouse Orthologue:
Pm20d1
Mouse Description:
peptidase M20 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442939]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17258 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054681 Nonsense 160 515 3 13
ENSDART00000136967 Nonsense 160 515 3 13
ENSDART00000139695   None 169 None 7
Genomic Location (Zv9):
Chromosome 23 (position 18197961)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18100900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGCCGGCTAATGAGGCRGATGGATGGGACGCTCCTCCTTTCTCTGCA[C/T]AGGAGATCRATGGATTCATTTAYGGACGAGGAACCATCGAYAATAAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link