mtnr1aa

Ensembl ID:
ENSDARG00000037545
ZFIN ID:
ZDB-GENE-990415-155
Description:
Melatonin receptor type 1A-A [Source:UniProtKB/Swiss-Prot;Acc:P51046]
Human Orthologue:
MTNR1A
Human Description:
melatonin receptor 1A [Source:HGNC Symbol;Acc:7463]
Mouse Orthologue:
Mtnr1a
Mouse Description:
melatonin receptor 1A Gene [Source:MGI Symbol;Acc:MGI:102967]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13199 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054674 Nonsense 69 350 2 2
ENSDART00000134561 None None 75 3 3
Genomic Location:
Chromosome 1 (position 16994601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTCTTTTTGTTTGYGTGTCCCACAGGTAACATTTTTGTGGTGAGTT[T/A]GGCAGTGGCRGACCTGGTGGTGGCCATTTACCCATATCCGCTGGTCYTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/345wnj91