fam58a

Ensembl ID:
ENSDARG00000037537
ZFIN ID:
ZDB-GENE-050522-495
Description:
Cyclin-related protein FAM58A [Source:UniProtKB/Swiss-Prot;Acc:Q503D6]
Human Orthologue:
FAM58A
Human Description:
family with sequence similarity 58, member A [Source:HGNC Symbol;Acc:28434]
Mouse Orthologue:
Fam58b
Mouse Description:
family with sequence similarity 58, member B Gene [Source:MGI Symbol;Acc:MGI:1916359]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43955 Nonsense Mutation detected in F1 DNA During 2016
sa37673 Essential Splice Site Available for shipment Available now
sa11608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054659 Nonsense 57 247 2 5
Genomic Location (Zv9):
Chromosome 23 (position 20265110)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20050217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCTGGGCATGAGATCTGTGCCCATGGCTACTGCATGTGTGCTGTA[T/G]CATAGGTTCTTCCAGTCTGCCAGTTTGCAGATCTATGAGCCTTATCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054659 Essential Splice Site 101 247 2 5
Genomic Location (Zv9):
Chromosome 23 (position 20264978)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20050085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAGAGCAGCATCTCAGGACCAGAGATATCATCAATGTCTGTCACAG[G/A]TAGCAGAAGGGTTATTGTAGCAGGGTGGACTCAGAATCCATTTAACGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054659 Nonsense 108 247 3 5
Genomic Location (Zv9):
Chromosome 23 (position 20264870)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20049977
KASP Assay ID:
2261-7573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGCTCATTTGTATTTTTCTTTGAWCCAGGTATTTTCATCCAGATAGT[G/T]AACCACTAGAACTTAATGGGAAGTTCTGGGAGTTGAGGGACAGCATTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link