fam58a

Ensembl ID:
ENSDARG00000037537
ZFIN ID:
ZDB-GENE-050522-495
Description:
Cyclin-related protein FAM58A [Source:UniProtKB/Swiss-Prot;Acc:Q503D6]
Human Orthologue:
FAM58A
Human Description:
family with sequence similarity 58, member A [Source:HGNC Symbol;Acc:28434]
Mouse Orthologue:
Fam58b
Mouse Description:
family with sequence similarity 58, member B Gene [Source:MGI Symbol;Acc:MGI:1916359]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054659 Nonsense 108 247 3 5
Genomic Location:
Chromosome 23 (position 20264870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGCTCATTTGTATTTTTCTTTGAWCCAGGTATTTTCATCCAGATAGT[G/T]AACCACTAGAACTTAATGGGAAGTTCTGGGAGTTGAGGGACAGCATTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nh2xcxew