mcm3l

Ensembl ID:
ENSDARG00000037532
ZFIN ID:
ZDB-GENE-040121-2
Description:
MCM3 minichromosome maintenance deficient 3-like [Source:RefSeq peptide;Acc:NP_001164539]
Human Orthologue:
MCM3
Human Description:
minichromosome maintenance complex component 3 [Source:HGNC Symbol;Acc:6945]
Mouse Orthologue:
Mcm3
Mouse Description:
minichromosome maintenance deficient 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101845]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7477 Missense Mutation detected in F1 DNA During 2014
sa23635 Nonsense Mutation detected in F1 DNA During 2014
sa14028 Nonsense Available for shipment Available now
sa1624 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054653 Missense 311 807 7 17
Genomic Location:
Chromosome 20 (position 6631634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCAGTTGRGTCGGTCTTTGGCCCCCAGCATTCATGGCCACGAGTACA[T/G]AAAGAAGGCCATTCTCTGTCTGCTGCTAGGAGGCAATGAGACCAACCTKG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054653 Nonsense 355 807 8 17
Genomic Location:
Chromosome 20 (position 6631089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTTTTTTAGGTGATCCTTCTGTCGCAAAGTCTCAGTTGCTGCGGTA[T/A]GTTTTGTTCACGGCACCAAGAGCAATTCCCACCACTGGACGGGGCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054653 Nonsense 473 807 10 17
Genomic Location:
Chromosome 20 (position 6629239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGACCAGTATAAGACCCCCATGGAGAACATCGGGCTCCAGGATTCCT[T/A]GCTTTCCAGATTTGATYTGCTCTTCATAGTTCTGGATCAGATGGATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054653 Nonsense 592 807 12 17
Genomic Location:
Chromosome 20 (position 6626248)
KASP Assay ID:
554-1565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGCCAGTGTTGACTCAGGAGGCATCAGACTATATAGCGGAGGAATA[T/A]TCTAGACTCCGGAGCCACGACCAAGTCAACAGTGAYTCTGCAAGGGTCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/06hw56dg