hdac3

Ensembl ID:
ENSDARG00000037514
ZFIN ID:
ZDB-GENE-040426-847
Description:
Histone deacetylase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q803C3]
Human Orthologue:
HDAC3
Human Description:
histone deacetylase 3 [Source:HGNC Symbol;Acc:4854]
Mouse Orthologue:
Hdac3
Mouse Description:
histone deacetylase 3 Gene [Source:MGI Symbol;Acc:MGI:1343091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35650 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa22434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054626 Splice Site, Nonsense 18 428 1 15

The following transcripts of ENSDARG00000037514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12437396)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11873169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATCGAACTGCGTACTTCTACGACCCAGACGTGGGGAACTTTCACTA[T/A]GGTAAGATTTTAACGTATCGTATAGCATAGGTTGCTAATGGATGATAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054626 Essential Splice Site 46 428 2 15

The following transcripts of ENSDARG00000037514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12446704)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11882477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCACACATAGTCTTGTACTTCATTATGGACTATACAAGAAGATGATGG[T/A]AGGAAAAACTGCTTAAAAATCTTTTTTTAGTCCAATCTCTTTTCTCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link