prps1b

Ensembl ID:
ENSDARG00000037506
ZFIN ID:
ZDB-GENE-030131-4011
Description:
ribose-phosphate pyrophosphokinase 1 [Source:RefSeq peptide;Acc:NP_001070036]
Human Orthologues:
PRPS1, PRPS1L1
Human Descriptions:
phosphoribosyl pyrophosphate synthetase 1 [Source:HGNC Symbol;Acc:9462]
phosphoribosyl pyrophosphate synthetase 1-like 1 [Source:HGNC Symbol;Acc:9463]
Mouse Orthologue:
Prps1
Mouse Description:
phosphoribosyl pyrophosphate synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:97775]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42360 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054619 Nonsense 146 318 4 7
Genomic Location (Zv9):
Chromosome 14 (position 12348017)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11783790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTCCTCCTTTTTAGGGTTTTTTTGACATTCCAGTGGACAATTTATA[T/A]GCAGAGCCTGCTGTTTTGAAATGGATTAAGGAAAATATACCTGAATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link