thoc2

Ensembl ID:
ENSDARG00000037503
ZFIN ID:
ZDB-GENE-030616-54
Description:
THO complex subunit 2 [Source:RefSeq peptide;Acc:NP_001003847]
Human Orthologue:
THOC2
Human Description:
THO complex 2 [Source:HGNC Symbol;Acc:19073]
Mouse Orthologues:
BC005561, Thoc2
Mouse Descriptions:
cDNA sequence BC005561 Gene [Source:MGI Symbol;Acc:MGI:3040669]
THO complex 2 Gene [Source:MGI Symbol;Acc:MGI:2442413]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42361 Nonsense Mutation detected in F1 DNA During 2016
sa13841 Nonsense Available for shipment Available now
sa17955 Nonsense Available for shipment Available now
sa6339 Nonsense Mutation detected in F1 DNA During 2016
sa35651 Nonsense Mutation detected in F1 DNA During 2016
sa16669 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Nonsense 157 1452 7 34
ENSDART00000054611 Nonsense 157 1504 7 36
ENSDART00000106626 Nonsense 157 1560 7 39
ENSDART00000115408 Nonsense 157 1560 7 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12672828)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12108601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATTTTCTTATTTAACTTTCCATCCTTCTCCCTGCAGTTACAAACAG[C/T]AAAAGTTCAATTTGTTGCGTGAGGAGAATGAAGGTTATGCTAAACTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Nonsense 538 1452 15 34
ENSDART00000054611 Nonsense 590 1504 16 36
ENSDART00000106626 Nonsense 603 1560 17 39
ENSDART00000115408 Nonsense 603 1560 17 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12695167)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12130940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYCATAACTCCAGTGGTGGACTCTCTCAAATACYTAACATCTCTCAACTA[T/G]GATGTACTGGCCTGTATCCNTTTYAAAAGGCTTTTATATATAAATATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Nonsense 806 1452 21 34
ENSDART00000054611 Nonsense 858 1504 22 36
ENSDART00000106626 Nonsense 871 1560 23 39
ENSDART00000115408 Nonsense 871 1560 23 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12713875)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12149648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGAGGCTGTMGTGTCTCTTCATTTGYCAAAGGTGTGGGATGATCTT[C/T]GACCACAATTCTACGCCACATTCTGGTCCCTCACCATGTATGACCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Nonsense 955 1452 24 34
ENSDART00000054611 Nonsense 1007 1504 25 36
ENSDART00000106626 Nonsense 1020 1560 26 39
ENSDART00000115408 Nonsense 1020 1560 26 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12718141)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12153914
KASP Assay ID:
554-4457.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCTAAATCTGTTTCTTTATTCATCTAGGTCTTCTCTGAYATCATCTA[T/G]ACGGTAGCGAGTTGCACAGAGAATGAGTCCCGCCGMTATGGTCGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Nonsense 972 1452 24 34
ENSDART00000054611 Nonsense 1024 1504 25 36
ENSDART00000106626 Nonsense 1037 1560 26 39
ENSDART00000115408 Nonsense 1037 1560 26 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12718191)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12153964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGTAGCGAGTTGCACAGAGAATGAGTCCCGCCGATATGGTCGTTTTT[T/A]GTGTTGCATGTTAGAGACTGTCACTCGATGGCACAGTGACAGAGCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054610 Splice Site, Nonsense 1382 1452 31 34
ENSDART00000054611 Splice Site, Nonsense 1434 1504 32 36
ENSDART00000106626 Splice Site, Nonsense 1459 1560 34 39
ENSDART00000115408 Splice Site, Nonsense 1459 1560 34 38

The following transcripts of ENSDARG00000037503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12739949)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12175722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCGCTCCAAAGAGAGGGAAAAGAAAGAAGACCGGAAGGACCGAAAA[C/T]GAGTAAGTCCTCTKTATTGGAGGAAGCAGTTTTTAAGCATCWCAAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link