gria3b

Ensembl ID:
ENSDARG00000037498
ZFIN ID:
ZDB-GENE-030616-53
Description:
glutamate receptor, ionotrophic, AMPA 3 precursor [Source:RefSeq peptide;Acc:NP_938174]
Human Orthologue:
GRIA3
Human Description:
glutamate receptor, ionotrophic, AMPA 3 [Source:HGNC Symbol;Acc:4573]
Mouse Orthologue:
Gria3
Mouse Description:
glutamate receptor, ionotropic, AMPA3 (alpha 3) Gene [Source:MGI Symbol;Acc:MGI:95810]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6340 Nonsense Mutation detected in F1 DNA During 2017
sa35652 Nonsense Available for shipment Available now
sa42362 Nonsense Mutation detected in F1 DNA During 2017
sa22436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 11 883 1 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13095178)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12530951
KASP Assay ID:
554-4458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAGAAGCTGAAAAAAANTGACTCAAAGCGCGTTGATTTTTTTATTAT[G/A]GCTTTTCGGCACGTCTCTCGCTGGCTTCCCCAATCAGATAAATATCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 126 883 3 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13035948)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12471721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCACACCTCCTTTGTCACACCCAGTTACCCCATCGACTCAGATGTG[C/T]AGTTTGTCATCCAGATGCGCCCTCCATTGAAGGGTGCTGTCTTAAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 249 883 6 15
Genomic Location (Zv9):
Chromosome 14 (position 12912403)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12348176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCATAATCTCTTTTCACAGGGCTTCACCAACATTAGCCTGGAC[A/T]AGGTCTTCCTTGGTGGAGCAAACATTAGTGGATTTCAGATAATTAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 739 883 13 15
Genomic Location (Zv9):
Chromosome 14 (position 12813098)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12248871
KASP Assay ID:
2260-7344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCTTGAATCCACCATGAATGAATACATTGAGCAGAGGAAGCCCTG[C/A]GACACGATGAAAGTGGGCGGCAATCTGGACTCTAAGGGCTATGGTGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link