gria4a

Ensembl ID:
ENSDARG00000037496
ZFIN ID:
ZDB-GENE-020125-7
Description:
glutamate receptor, ionotropic, AMPA 4a [Source:RefSeq peptide;Acc:NP_999971]
Human Orthologue:
GRIA4
Human Description:
glutamate receptor, ionotrophic, AMPA 4 [Source:HGNC Symbol;Acc:4574]
Mouse Orthologue:
Gria4
Mouse Description:
glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35998 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042083 Essential Splice Site 157 898 3 16
ENSDART00000054599 Essential Splice Site 157 898 3 16
Genomic Location (Zv9):
Chromosome 15 (position 43526519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44736178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCACTATGACTGGAGCCGCTTCGTGTTCCTGTACGACACCGACAGAG[G/T]TAAAGACACACACATGCATACACCTTTATCAGCTGTACTGAAGAGGAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link