rtn4rl2b

Ensembl ID:
ENSDARG00000037495
ZFIN ID:
ZDB-GENE-040310-2
Description:
reticulon 4 receptor-like 2b [Source:RefSeq peptide;Acc:NP_982350]
Human Orthologue:
RTN4RL2
Human Description:
reticulon 4 receptor-like 2 [Source:HGNC Symbol;Acc:23053]
Mouse Orthologue:
Rtn4rl2
Mouse Description:
reticulon 4 receptor-like 2 Gene [Source:MGI Symbol;Acc:MGI:2669796]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35658 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054598 Nonsense 426 457 3 3
Genomic Location (Zv9):
Chromosome 14 (position 15032045)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16894031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGCAGCCTCAGTTCGCTGTTTCGAACTTGAATGTCCACCAGGTTA[C/A]GACTCTCCCATTCTCCCATCTTCCTCTTCGTCTTCACTTCTGTCTTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link