canx

Ensembl ID:
ENSDARG00000037488
ZFIN ID:
ZDB-GENE-040426-2797
Description:
calnexin [Source:RefSeq peptide;Acc:NP_998613]
Human Orthologue:
CANX
Human Description:
calnexin [Source:HGNC Symbol;Acc:1473]
Mouse Orthologue:
Canx
Mouse Description:
calnexin Gene [Source:MGI Symbol;Acc:MGI:88261]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2776 Nonsense Mutation detected in F1 DNA During 2016
sa102 Nonsense Available for shipment Available now
sa42364 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089021 Nonsense 108 600 4 15
Genomic Location:
Chromosome 14 (position 14139525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTATCTCAGGCCAAGAAGGATGGCATCGATGAAGACATTGCCAAATA[T/G]GACGGTCAGTTCAACATGTCATGAATCTAATACGTCATAATAGCAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089021 Nonsense 145 600 5 15
Genomic Location:
Chromosome 14 (position 14139108)
KASP Assay ID:
554-0129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTTGAAATCCAAAGCCAAGCACCATGCCATCTCTGCCCTCCTACTG[C/T]GACCTTTTACCTTTGACACCAAACCACTCATTGTCCAGTGAGTATTCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089021 Nonsense 158 600 6 15
Genomic Location:
Chromosome 14 (position 14138836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAATGATAAAATATATGACAGTAACCCTCAATGTTTCCTCAGGTA[T/A]GAAGTAAACTTCCAGACTGGAATTGACTGTGGTGGGGCTTATGTTAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link