canx

Ensembl ID:
ENSDARG00000037488
ZFIN ID:
ZDB-GENE-040426-2797
Description:
calnexin [Source:RefSeq peptide;Acc:NP_998613]
Human Orthologue:
CANX
Human Description:
calnexin [Source:HGNC Symbol;Acc:1473]
Mouse Orthologue:
Canx
Mouse Description:
calnexin Gene [Source:MGI Symbol;Acc:MGI:88261]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa102 Nonsense Available for shipment Available now
sa42364 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089021 Nonsense 145 600 5 15
Genomic Location (Zv9):
Chromosome 14 (position 14139108)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16151058
KASP Assay ID:
554-0129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTTGAAATCCAAAGCCAAGCACCATGCCATCTCTGCCCTCCTACTG[C/T]GACCTTTTACCTTTGACACCAAACCACTCATTGTCCAGTGAGTATTCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089021 Nonsense 158 600 6 15
Genomic Location (Zv9):
Chromosome 14 (position 14138836)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16150786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAATGATAAAATATATGACAGTAACCCTCAATGTTTCCTCAGGTA[T/A]GAAGTAAACTTCCAGACTGGAATTGACTGTGGTGGGGCTTATGTTAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link