cdh8

Ensembl ID:
ENSDARG00000037478
Human Orthologue:
CDH8
Human Description:
cadherin 8, type 2 [Source:HGNC Symbol;Acc:1767]
Mouse Orthologue:
Cdh8
Mouse Description:
cadherin 8 Gene [Source:MGI Symbol;Acc:MGI:107434]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7081 Nonsense Mutation detected in F1 DNA During 2016
sa34141 Nonsense Mutation detected in F1 DNA During 2016
sa13070 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054552 Nonsense 16 711 1 10
Genomic Location (Zv9):
Chromosome 7 (position 42291495)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42893921
KASP Assay ID:
554-5291.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCTCCATACCGATTTGGACGTGGGCAGTAAGAACATCAAGTATGTGT[T/A]GGCGGGCGAAGGGGCGGGCWCCATCTTCGCCATCAATGAGAGGACGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054552 Nonsense 419 711 7 10
Genomic Location (Zv9):
Chromosome 7 (position 42374645)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42810872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACGACAACGCCCCCGAGTTCGCCACCGAATACGAAGCCTTCCTTTG[T/A]GAAAACGGCAAACCCGGACAGGTAAGAGGGCATCAATCAGAGCCGCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054552 Nonsense 558 711 10 10
Genomic Location (Zv9):
Chromosome 7 (position 42389200)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42796317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGTTCTTGTGCCTTTCAGTCATCGTGGTSTTGTTTGTGACTTTGAGG[C/T]GACACAAGAACGAGCCGCTGATCATCAAAGACGACGAGGACGTGAGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link