fmr1

Ensembl ID:
ENSDARG00000037433
ZFIN ID:
ZDB-GENE-020731-6
Description:
fragile X mental retardation 1 [Source:RefSeq peptide;Acc:NP_694495]
Human Orthologue:
FMR1
Human Description:
fragile X mental retardation 1 [Source:HGNC Symbol;Acc:3775]
Mouse Orthologue:
Fmr1
Mouse Description:
fragile X mental retardation syndrome 1 homolog Gene [Source:MGI Symbol;Acc:MGI:95564]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa992 Nonsense Available for shipment Available now
hu2787 Nonsense Confirmed mutation in F2 line Unknown
sa10402 Essential Splice Site Available for shipment Available now
sa19080 Essential Splice Site Mutation detected in F1 DNA During 2014
hu2898 Essential Splice Site Confirmed mutation in F2 line Unknown
sa22461 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Nonsense 40 493 3 15
ENSDART00000054476 Nonsense 40 569 3 15
ENSDART00000123434 Nonsense 40 569 3 16
ENSDART00000129431 Nonsense 40 492 3 14
Genomic Location:
Chromosome 14 (position 21160395)
KASP Assay ID:
554-0896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTAAAATATATTCCCATATTTTATCACTATGCAGTTGGCAGCCAGAA[C/T]GACAGATTTCTTTCCAGGATGTTCGGTTTCCACCTCCAACCGGTTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2787
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Nonsense 113 493 5 15
ENSDART00000054476 Nonsense 113 569 5 15
ENSDART00000123434 Nonsense 113 569 5 16
ENSDART00000129431 Nonsense 113 492 5 14
Genomic Location:
Chromosome 14 (position 21161310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCCTGTGATGCCACCCTAAATGAAATCGTCACATTAGAGAGGCTA[C/T]GACCTGTGAACCCCAACAAAGCAGCAACAAAGAACACCTTTCTCAAAACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Essential Splice Site 140 493 5 15
ENSDART00000054476 Essential Splice Site 140 569 5 15
ENSDART00000123434 Essential Splice Site 140 569 5 16
ENSDART00000129431 Essential Splice Site 140 492 5 14
ENSDART00000054473 Essential Splice Site 140 493 5 15
ENSDART00000054476 Essential Splice Site 140 569 5 15
ENSDART00000123434 Essential Splice Site 140 569 5 16
ENSDART00000129431 Essential Splice Site 140 492 5 14
Genomic Location:
Chromosome 14 (position 21161394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCTTTCTCAAAACCAGACTAGATGTWCCTGAAGACTTGAGACAGATG[T/A]AAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Essential Splice Site 140 493 5 15
ENSDART00000054476 Essential Splice Site 140 569 5 15
ENSDART00000123434 Essential Splice Site 140 569 5 16
ENSDART00000129431 Essential Splice Site 140 492 5 14
ENSDART00000054473 Essential Splice Site 140 493 5 15
ENSDART00000054476 Essential Splice Site 140 569 5 15
ENSDART00000123434 Essential Splice Site 140 569 5 16
ENSDART00000129431 Essential Splice Site 140 492 5 14
Genomic Location:
Chromosome 14 (position 21161394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTTTCTCAAAACCAGACTAGATGTTCCTGAAGACTTGAGACAGATG[T/A]AAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2898
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Essential Splice Site 211 493 8 15
ENSDART00000054476 Essential Splice Site 211 569 8 15
ENSDART00000123434 Essential Splice Site 211 569 8 16
ENSDART00000129431 Essential Splice Site 211 492 8 14
Genomic Location:
Chromosome 14 (position 21169096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAATATTAAAAACAGGTAAGATTCAAAATCTTGTTATATCTTCATC[A/G]GAGTTCTCGGCAGCTGGCCTCAAGGTTTCATGAACAGTTTGTGGTGCGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054473 Nonsense 389 493 12 15
ENSDART00000054476 Nonsense 389 569 12 15
ENSDART00000123434 Nonsense 389 569 12 16
ENSDART00000129431 Nonsense 389 492 12 14
Genomic Location:
Chromosome 14 (position 21177110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGATGAGCAGCTTAGACAGATCGGTGGAGGACCCAGAGCTTTGCCGGGA[C/T]GACCCGAGAAAGAAAAGTCTTTCATGGCTGATAATGGAATGGGACCCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/exrtp8s7