haus7

Ensembl ID:
ENSDARG00000037432
ZFIN ID:
ZDB-GENE-050506-15
Description:
Im:6894757 protein [Source:UniProtKB/TrEMBL;Acc:Q1RM89]
Human Orthologue:
HAUS7
Human Description:
HAUS augmin-like complex, subunit 7 [Source:HGNC Symbol;Acc:32979]
Mouse Orthologue:
Haus7
Mouse Description:
HAUS augmin-like complex, subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1920988]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43952 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29904 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111720 Essential Splice Site 151 384 None 12
ENSDART00000125066 Essential Splice Site 146 379 None 10

The following transcripts of ENSDARG00000037432 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20118697)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19903804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGCAGCTTCTAAGGGTTATTCAAGCAGACTCCTCTCTGTGCTCTGGG[T/C]AACTCTTAAAGCATTTTGTAATAGTGATTTAACTAAATATGCTCTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111720 Essential Splice Site 328 384 9 12
ENSDART00000125066 Essential Splice Site 323 379 9 10

The following transcripts of ENSDARG00000037432 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20114499)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19899606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGCTTATTCAAATACAAATACTTAGCATTTTCTTTGTGTCCTTTTC[A/G]GGAGCTGGAGGCTGTGAAGCAGCTTTCTGAAACTTCCACGTCTCTTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link