tll1

Ensembl ID:
ENSDARG00000037429
ZFIN ID:
ZDB-GENE-041020-1
Description:
Dorsal-ventral patterning tolloid-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:O57460]
Human Orthologue:
TLL1
Human Description:
tolloid-like 1 [Source:HGNC Symbol;Acc:11843]
Mouse Orthologue:
Tll1
Mouse Description:
tolloid-like Gene [Source:MGI Symbol;Acc:MGI:106923]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19476 Nonsense Mutation detected in F1 DNA During 2014
sa387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054472 Nonsense 112 1022 4 22
Genomic Location:
Chromosome 1 (position 19574122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGAGGTCTAGGAGAACATGTGCCCACTAAGAAGAGGGGTTCCTTATA[T/A]CTGCTGCTAGACAGAATACGACGGTTAGGTTTTGGTAAGTTCACACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054472 Nonsense 529 1022 14 22
Genomic Location:
Chromosome 1 (position 19545245)
KASP Assay ID:
554-0248.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTTGTTTGTGCAGATCGAGAGGCATGACAGCTGTGCATACGACTATT[T/A]GGAGGTTAGAGATGGATTGTCAGAGAACAGCCCTCTGATTGGTCGATTCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 24 hpf

Control on top; Mutant below; 24 hpf

zoom

Control; 24 hpf

Control; 24 hpf

zoom

Mutant; 24 hpf

Mutant; 24 hpf

zoom

Mutant; 24 hpf

Mutant; 24 hpf

zoom

Stage Entity Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
caudal fin
ZFA:0001058
ventral region
BSPO:0000084
hypoplastic
PATO:0000645
abnormal
PATO:0000460
Pharyngula:Prim-5
ZFS:0000029
whole organism
ZFA:0001094

dorsalized
PATO:0000620
abnormal
PATO:0000460

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tctyby16