si:ch211-39a7.1

Ensembl ID:
ENSDARG00000037427
ZFIN ID:
ZDB-GENE-060503-606
Description:
neuronal nicotinic acetylocholine receptor alpha-7 subunit-like [Source:RefSeq peptide;Acc:NP_00103
Human Orthologues:
CHRFAM7A, CHRNA7
Human Descriptions:
cholinergic receptor, nicotinic, alpha 7 [Source:HGNC Symbol;Acc:1960]
CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence simila
Mouse Orthologue:
Chrna7
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 7 Gene [Source:MGI Symbol;Acc:MGI:99779]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077953 Nonsense 40 571 1 9
ENSDART00000138971 Nonsense 58 589 2 10

The following transcripts of ENSDARG00000037427 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9346884)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8805423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGTAGCCAACGACTCKCAACCCCTCACCGTCTWCCTKTCWATGAGCT[T/A]GATACAGATCATGGATGTTGTAAGTCTCTCTKTTCCCTCTTACTTATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link