s100a10a

Ensembl ID:
ENSDARG00000037425
ZFIN ID:
ZDB-GENE-041010-35
Description:
S100 calcium binding protein A10a [Source:RefSeq peptide;Acc:NP_001005961]
Human Orthologues:
S100A10, S100A11
Human Descriptions:
S100 calcium binding protein A10 [Source:HGNC Symbol;Acc:10487]
S100 calcium binding protein A11 [Source:HGNC Symbol;Acc:10488]
Mouse Orthologues:
Gm5068, Gm7665, S100a10, S100a11
Mouse Descriptions:
predicted gene 5068 Pseudogene [Source:MGI Symbol;Acc:MGI:3645720]
predicted pseudogene 7665 Pseudogene [Source:MGI Symbol;Acc:MGI:3645651]
S100 calcium binding protein A10 (calpactin) Gene [Source:MGI Symbol;Acc:MGI:1339468]
S100 calcium binding protein A11 (calgizzarin) Gene [Source:MGI Symbol;Acc:MGI:1338798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43222 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054469 Nonsense 18 102 2 3
Genomic Location (Zv9):
Chromosome 19 (position 9229604)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8688143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCCGAACTAGAGACCGCCATGGAGTCCCTCATCATGGTTTTCCAC[C/T]GATATGCTGGAAAGGAGGGCAGGAGCGGCACCCTGACCCGACGGGAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link