egr1

Ensembl ID:
ENSDARG00000037421
ZFIN ID:
ZDB-GENE-980526-320
Description:
Early growth response protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P26632]
Human Orthologue:
EGR1
Human Description:
early growth response 1 [Source:HGNC Symbol;Acc:3238]
Mouse Orthologue:
Egr1
Mouse Description:
early growth response 1 Gene [Source:MGI Symbol;Acc:MGI:95295]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa64 Nonsense Available for shipment Available now
sa66 Nonsense Available for shipment Available now
sa42385 Nonsense Mutation detected in F1 DNA During 2016
sa469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa64
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054460 Nonsense 138 511 2 2
Genomic Location (Zv9):
Chromosome 14 (position 22336110)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21037598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGTGGGCTGGTGGGCATCAACCCACCCCCAGCCTCCATCCCGTCCT[C/A]AACCTCTCAGGCAACTCACCCCTCTTCCTCTTCCACGTCTTCCATCCCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa66
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054460 Nonsense 138 511 2 2
Genomic Location (Zv9):
Chromosome 14 (position 22336110)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21037598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGTGGGCTGGTGGGCATCAACCCACCCCCAGCCTCCATCCCGTCCT[C/A]AACCTCTCAGGCAACTCACCCCTCTTCCTCTTCCACGTCTTCCATCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054460 Nonsense 239 511 2 2
Genomic Location (Zv9):
Chromosome 14 (position 22335808)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21037296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCAGCTTCTCTGTGCCAATGATCCCTGACTACCTGTTTACACAGCAG[C/T]AAAGTGAGATCAGCCTGGTGCCACCAGATCAGAAACCCATCCAGACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054460 Nonsense 278 511 2 2
Genomic Location (Zv9):
Chromosome 14 (position 22335691)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21037179
KASP Assay ID:
554-0201.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGACGCCGCTGCACACCATCAAGGCCTTTGCAACCCAAACGGGTTCA[C/T]AGGACCTGAAAAGCGTCTACCAGTCTCAGCTCATCAAGCCCAGTCGCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link