si:ch211-248a16.1

Ensembl ID:
ENSDARG00000037415
ZFIN ID:
ZDB-GENE-091116-98
Human Orthologue:
DLGAP1
Human Description:
discs, large (Drosophila) homolog-associated protein 1 [Source:HGNC Symbol;Acc:2905]
Mouse Orthologue:
Dlgap1
Mouse Description:
discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6758 Nonsense Mutation detected in F1 DNA During 2017
sa32477 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054452 Nonsense 69 980 1 10
ENSDART00000142971   None 663 None 9
Genomic Location (Zv9):
Chromosome 24 (position 8962945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9022324
KASP Assay ID:
554-5338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGATCTGGCCAGCAGCACATTTCCACGCAGACATCATGGCTCGCATCAT[G/T]AGCTTAAGGACGAACGTGCCATAGTGCCCTATGTGGGACCAGGGGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054452 Essential Splice Site 430 980 None 10
ENSDART00000142971 Essential Splice Site 73 663 None 9
Genomic Location (Zv9):
Chromosome 24 (position 8988514)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9047398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACACCTGTTCACGTTCTTTCTTCTTCTGCTTCTTCCTCTTTTTTTGA[A/G]GGATCAGTGCGGAGTCGCATTCCCCCAAGCTGCAGATTCGGAGTCACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link