hspa8l

Ensembl ID:
ENSDARG00000037403
ZFIN ID:
ZDB-GENE-031217-2
Description:
Heat shock cognate 70 kDa protein [Source:UniProtKB/TrEMBL;Acc:O42359]
Human Orthologue:
HSPA8
Human Description:
heat shock 70kDa protein 8 [Source:HGNC Symbol;Acc:5241]
Mouse Orthologue:
Hspa8
Mouse Description:
heat shock protein 8 Gene [Source:MGI Symbol;Acc:MGI:105384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42524 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043743 Nonsense 533 647 8 9
Genomic Location (Zv9):
Chromosome 15 (position 18566017)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19726466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCATGGTCCAGGAAGCTGAGAAGTACAAGGCTGAGGACGATGTCCAA[C/T]GAGAAAAGGTTAGTGCCAAAAACGGCCTTGAGTCCTACTCCTTCAACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link