lim2.3

Ensembl ID:
ENSDARG00000037402
ZFIN ID:
ZDB-GENE-040718-327
Description:
lens intrinsic membrane protein 2.3 [Source:RefSeq peptide;Acc:NP_001002587]
Human Orthologue:
LIM2
Human Description:
lens intrinsic membrane protein 2, 19kDa [Source:HGNC Symbol;Acc:6610]
Mouse Orthologue:
Lim2
Mouse Description:
lens intrinsic membrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:104698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35861 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054426 Nonsense 37 172 2 5
ENSDART00000134321 Nonsense 9 144 2 5

The following transcripts of ENSDARG00000037402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 18573420)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19719063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCACTGCCACCGATTACTGGATGCAGTACCGCCAGTCCAGCAGCTA[C/A]ATGCACCAGGGCCTATGGCGCTACTGTGTACCTGGAAAATGCATGACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link