pax5

Ensembl ID:
ENSDARG00000037383
ZFIN ID:
ZDB-GENE-001030-2
Description:
paired box protein Pax-2a [Source:RefSeq peptide;Acc:NP_571713]
Human Orthologue:
PAX5
Human Description:
paired box 5 [Source:HGNC Symbol;Acc:8619]
Mouse Orthologue:
Pax5
Mouse Description:
paired box gene 5 Gene [Source:MGI Symbol;Acc:MGI:97489]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19482 Essential Splice Site Available for shipment Available now
sa16357 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054395 Essential Splice Site 277 395 8 11
ENSDART00000076986 Essential Splice Site 306 424 8 11
ENSDART00000132602 Essential Splice Site 278 396 8 11
Genomic Location (Zv9):
Chromosome 1 (position 20633639)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21105735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAATGGAGTTGATGCTAATCATGCAAGCAATGCTCTTTTATTTTGACA[G/A]GTCGTGACCTGGCCAGCACAACACTCCCAGGATACCCTCCTCATGTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054395 Splice Site, Nonsense 312 395 9 11
ENSDART00000076986 Splice Site, Nonsense 341 424 9 11
ENSDART00000132602 Splice Site, Nonsense 313 396 9 11
Genomic Location (Zv9):
Chromosome 1 (position 20642113)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21114209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACATGTACACATCTAACATTTCTGTTGTGTTTTCTAACATTTCAGGW[G/T]GAGATTTCYCTGGCAGTCCTTATTCCCATCCACAGTATTCAACATACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link