ephb2

Ensembl ID:
ENSDARG00000037373
ZFIN ID:
ZDB-GENE-070713-2
Human Orthologue:
EPHB2
Human Description:
EPH receptor B2 [Source:HGNC Symbol;Acc:3393]
Mouse Orthologue:
Ephb2
Mouse Description:
Eph receptor B2 Gene [Source:MGI Symbol;Acc:MGI:99611]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24316 Nonsense Mutation detected in F1 DNA During 2014
sa8012 Nonsense Mutation detected in F1 DNA During 2014
sa4235 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8011 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047784 Nonsense 41 987 2 16
ENSDART00000148120 Nonsense 21 966 1 15
Genomic Location:
Chromosome 23 (position 22199540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCCACGACGGCGACTGCAGAGCTGGGCTGGACGATATATCCATCAT[T/A]GGGGGTGAGCCTCGTTGAAATAATTTAGATGATCATCAAACCTAGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047784 Nonsense 127 987 3 16
ENSDART00000148120 Nonsense 107 966 2 15
Genomic Location:
Chromosome 23 (position 22199016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATCTGTACTATTTTGAATCAGACTCTGATACAGCCACTAAGGTGTA[T/A]CCCGCCTGGATGGARAACCCTTGGGTCAAGGTGGACACCATTGCGGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047784 Essential Splice Site 567 987 8 16
ENSDART00000148120 Essential Splice Site 547 966 7 15
Genomic Location:
Chromosome 23 (position 22108697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTGTTTTCCTCATCGCTGTGGTTGTGCTCATTATCGTCTGTAATCGG[T/G]GAGTCTGTTACATGTAGCAATCAAAATCTGGAATCAATTAAACAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047784 Essential Splice Site 952 987 15 16
ENSDART00000148120 Essential Splice Site 931 966 14 15
Genomic Location:
Chromosome 23 (position 22101193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGAAGACCTCACTACCTTCGAAGCYGTGTCCCAGATGACTATRGAG[T/C]ATGTTTTYCCTGTCTACCATGCWGGCCACCAWATTAAAAAGAATAATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/criivl3q