ephb2

Ensembl ID:
ENSDARG00000037373
ZFIN ID:
ZDB-GENE-070713-2
Human Orthologue:
EPHB2
Human Description:
EPH receptor B2 [Source:HGNC Symbol;Acc:3393]
Mouse Orthologue:
Ephb2
Mouse Description:
Eph receptor B2 Gene [Source:MGI Symbol;Acc:MGI:99611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24316 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047784 Nonsense 41 987 2 16
ENSDART00000148120 Nonsense 21 966 1 15
Genomic Location (Zv9):
Chromosome 23 (position 22199540)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21978847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCCACGACGGCGACTGCAGAGCTGGGCTGGACGATATATCCATCAT[T/A]GGGGGTGAGCCTCGTTGAAATAATTTAGATGATCATCAAACCTAGCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link