scube2

Ensembl ID:
ENSDARG00000037362
ZFIN ID:
ZDB-GENE-050302-80
Description:
Signal peptide, CUB and EGF-like domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5G872
Human Orthologue:
SCUBE2
Human Description:
signal peptide, CUB domain, EGF-like 2 [Source:HGNC Symbol;Acc:30425]
Mouse Orthologue:
Scube2
Mouse Description:
signal peptide, CUB domain, EGF-like 2 Gene [Source:MGI Symbol;Acc:MGI:1928765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38613 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14283 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054366 Essential Splice Site 68 1010 2 23
Genomic Location (Zv9):
Chromosome 7 (position 29946733)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28339256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTGCACTTGCAAAACAGGCTTTAAAGGGGACGGAAAACACTGTGAAG[G/A]TAACAGCTCTGTTAGTCAGTGGAATATTCAATATTATAGTAAATACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054366 Essential Splice Site 582 1010 15 23
Genomic Location (Zv9):
Chromosome 7 (position 29923460)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28315983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATTACTGCCCAGTTTGAGCTGGATGTGAACCTGGAGGAGGTAACAG[G/A]TTGGTTTTGTGTACCGCATGCGTACGTWWCACTATAAACCTTCTCATTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link