polr3e

Ensembl ID:
ENSDARG00000037358
ZFIN ID:
ZDB-GENE-030131-8462
Description:
DNA-directed RNA polymerase III subunit RPC5 [Source:RefSeq peptide;Acc:NP_997919]
Human Orthologue:
POLR3E
Human Description:
polymerase (RNA) III (DNA directed) polypeptide E (80kD) [Source:HGNC Symbol;Acc:30347]
Mouse Orthologue:
Polr3e
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide E Gene [Source:MGI Symbol;Acc:MGI:1349452]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41928 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38864 Nonsense Mutation detected in F1 DNA During 2017
sa21993 Nonsense Available for shipment Available now
sa24899 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105292 Essential Splice Site 13 696 1 20
Genomic Location (Zv9):
Chromosome 12 (position 1228985)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 996343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTTCATTATGGCCAGTGGAGACGATGATGATCCCATCATACAGGAGG[T/G]AAATGTAAACATGATCGTCACACTGCAGAGTTAGGCGTCTGTCTTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105292 Nonsense 153 696 6 20
Genomic Location (Zv9):
Chromosome 12 (position 1224472)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 991830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACCCAGCTTCACCTATCTGGATAAAGCAGATACGAAACATCGAGAA[C/T]GAGAAGCTGCCAATGAAGGTGGGAGGATGTTTTTGGGTCACTTTCATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105292 Nonsense 606 696 17 20
Genomic Location (Zv9):
Chromosome 12 (position 1216105)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 983463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGACGGACCGCATGCTGCAGGACACCATCCTGCACAGCCACTGCAAG[C/T]AGATCCTCGTGCCTGTAAGTACTGCAGTGTGTGTTTTTATTGAACTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105292 Essential Splice Site 678 696 19 20
Genomic Location (Zv9):
Chromosome 12 (position 1212827)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 980185
KASP Assay ID:
554-7790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTCGGAGACGCCGTCAACAAGACTGATGTGGACCGACTGCTCAAG[G/A]TGAACACCAGCTCAAACATCAGGAGTCTTAAAGGGACAGTGCACACAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link