LOC100332293

Ensembl ID:
ENSDARG00000037357
Human Orthologue:
WIPI1
Human Description:
WD repeat domain, phosphoinositide interacting 1 [Source:HGNC Symbol;Acc:25471]
Mouse Orthologue:
Wipi1
Mouse Description:
WD repeat domain, phosphoinositide interacting 1 Gene [Source:MGI Symbol;Acc:MGI:1261864]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31850 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41929 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054353 Essential Splice Site 244 413 9 13
Genomic Location (Zv9):
Chromosome 12 (position 1241986)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1009254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACACCGAGACGGTTCACGTCTTCAAACTGGAGCATCACAGTCCCAA[G/T]TAATCAAACACATCATGAAAATGATCAACATGTGTTACATGCACAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054353 Essential Splice Site 333 413 11 13
Genomic Location (Zv9):
Chromosome 12 (position 1238122)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1005390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGAATCTGCAGGATGGTGGAGACTGTCGTTTAGTCCAGAAGCACAG[G/A]TCACAATACACATTATTACTGAACACAATTAGCTTTAGCTTTTTTGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link