ghrhr

Ensembl ID:
ENSDARG00000037341
ZFIN ID:
ZDB-GENE-050315-2
Description:
growth hormone releasing hormone receptor [Source:RefSeq peptide;Acc:NP_001124524]
Human Orthologue:
GHRHR
Human Description:
growth hormone releasing hormone receptor [Source:HGNC Symbol;Acc:4266]
Mouse Orthologue:
Ghrhr
Mouse Description:
growth hormone releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95710]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19901 Nonsense Available for shipment Available now
sa38360 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44550 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054331 Nonsense 126 432 5 13
Genomic Location (Zv9):
Chromosome 2 (position 52483482)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51200379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAGTCTTTTTTGCTCTTTGCATTTATTTTTTCAGACAACCTACTTAT[C/A]GACTTTAAAACAGCTTTACACCGCAGGATACGCAACATCGCTAATATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054331 Essential Splice Site 250 432 7 13
Genomic Location (Zv9):
Chromosome 2 (position 52491386)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51192475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTCTCGCAGAGGAAATACTTCTGGTGGTACATTCTCATCGGATGGGG[T/A]TCGTAAAACCTGAAAAACAGCACAGAAAAAAAACACAAGCTTCCAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054331 Nonsense 391 432 13 13
Genomic Location (Zv9):
Chromosome 2 (position 52511594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGGTTTCTTTCTCTTTCAGGTCCAGGCTGAGCTAAAGCGCAGGTTAT[G/A]GACGTGGCAAACACAAACACACCTGAGCCCGTGTAAAAAGCGTCGTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link